Sneakers Stats Digital Cryptocurrency Game Dog - Mix of Grey Wolf, Husky, Pug, Corgi and German Shepard

Achievements

None
Sneakers Stats
Howdy! I'm Sneakers Stats. Once you go digital, baby, you never go back. I really dislike stinky flea collars. I like giving wet kisses. I don't mind sharing my bed with someone I just met, if we can cuddle. My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 23%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACACCCAGCTCACCCGAACCCCCCCCCGAA
A
C
A
A
C
A
C
C
C
A
G
C
T
C
A
C
C
C
G
A
A
C
C
C
C
C
C
C
C
C
G
A
A
Genes: 44LO7L2LLL2

Composition

Grey Wolf
45%
Husky
18%
Pug
18%
Corgi
9%
German Shepard
9%

Current Energy

Vitality -24 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Husky
Legs Grey Wolf
Front Legs Corgi
Head German Shepard
Ears Grey Wolf
Snout Pug
Mouth Grey Wolf
Nose Grey Wolf
Eyes Grey Wolf
Color Pug