Trouble Tesla Litecoin Game Dog - Mix of Grey Wolf, Husky, Corgi, German Shepard, Poodle and Labrador BK

Achievements

None
Trouble Tesla
How goes it? I'm Trouble Tesla. I make the best virtual pet. The place I like most in the world is curled up in my human's bed, hogging all the covers! Are you into garbage cans? I am. I don't like to be ignored. I need laid otherwise I'm going to start agreeing with Grumpy Cat.
  • Purity 13%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACACCCAGCTCACCCGACCCCGCACCCAGC
A
C
A
A
C
A
C
C
C
A
G
C
T
C
A
C
C
C
G
A
C
C
C
C
G
C
A
C
C
C
A
G
C
Genes: 44LO7LIL6LO

Composition

Grey Wolf
36%
Husky
18%
Corgi
18%
German Shepard
9%
Poodle
9%
Labrador BK
9%

Current Energy

Vitality -24 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail Husky
Legs Grey Wolf
Front Legs Corgi
Head German Shepard
Ears Grey Wolf
Snout Poodle
Mouth Grey Wolf
Nose Labrador BK
Eyes Grey Wolf
Color Corgi