Travis Topaz Cryptocurrency Game Dog - Mix of Golder Retriever, Border Collie and Shiba Inu

Achievements

None
Travis Topaz
Ima Ethernet dog. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. If you enjoy growling through fences as much as I do, we should get together. They say my bite is worse than my bark. I enjoy finding and eating frozen cat turds in the winter. Bon appétit!
  • Purity 65%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 82%
  • 0 races
  • Gen 11
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATACAGAAGAAGAAGAAGAGTAAGAAGAAGA
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
G
T
A
A
G
A
A
G
A
A
G
A
Genes: 8J88888E888

Composition

Golder Retriever
82%
Border Collie
9%
Shiba Inu
9%

Current Energy

Vitality -23 points
Lunar Effect +16 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Golder Retriever
Snout Golder Retriever
Mouth Shiba Inu
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever