Francais Fawful Cryptocurrency Game Dog - Mix of Labrador BK, Golder Retriever, Poodle, Corgi, Schnauzer, Labrador and Border Collie

Achievements

None
Francais Fawful
What's up? I'm Francais Fawful. I'm a super-dog in the internet universe. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Labrador BK 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGCAGACAGCAGAATAAGAGCACCAGCATAC
G
C
A
G
C
A
G
A
C
A
G
C
A
G
A
A
T
A
A
G
A
G
C
A
C
C
A
G
C
A
T
A
C
Genes: 66IO8C8656J

Composition

Labrador BK
36%
Golder Retriever
18%
Poodle
9%
Corgi
9%
Schnauzer
9%
Labrador
9%
Border Collie
9%

Current Energy

Vitality -28 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Poodle
Front Legs Corgi
Head Golder Retriever
Ears Schnauzer
Snout Golder Retriever
Mouth Labrador BK
Nose Labrador
Eyes Labrador BK
Color Border Collie

Parents

No Children