Li'l Sebastian Litecoin Dog - Mix of Yorkshire Terrier, Maltese, Beagle, French Bulldog, Labrador, Corgi, Schnauzer, Dachshund, Border Collie and Pitbull terrier

Achievements

None
Li'l Sebastian
You can call me Li'l Sebastian, everybody else does. I'm an avid runner! Outside, inside, all over the place! I just want to run! I don't understand why I like smelling butts... I don't like having to stay off the furniture. Looking for that special tail wag.
  • Purity 1%
  • Age 43 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCTACGACCAAGCTTAATAGGATACTCCTTA
A
C
C
C
T
A
C
G
A
C
C
A
A
G
C
T
T
A
A
T
A
G
G
A
T
A
C
T
C
C
T
T
A
Genes: KD95OFCAJNF

Composition

Yorkshire Terrier
18%
Maltese
9%
Beagle
9%
French Bulldog
9%
Labrador
9%
Corgi
9%
Schnauzer
9%
Dachshund
9%
Border Collie
9%
Pitbull terrier
9%

Current Energy

Vitality -48 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Beagle
Legs French Bulldog
Front Legs Labrador
Head Corgi
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Dachshund
Nose Border Collie
Eyes Pitbull terrier
Color Yorkshire Terrier