Li'l Sebastian Litecoin Dog - Mix of Yorkshire Terrier, Maltese, Beagle, French Bulldog, Labrador, Corgi, Schnauzer, Dachshund, Border Collie and Pitbull terrier

Achievements

Racer
Li'l Sebastian
You can call me Li'l Sebastian, everybody else does. I'm an avid runner! Outside, inside, all over the place! I just want to run! I don't understand why I like smelling butts... I don't like having to stay off the furniture. Looking for that special tail wag.
  • Purity 1%
  • Age 39 months
  • Racing Exp 8
  • Yorkshire Terrier 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 1 0
 Best Time16.73 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCCTACGACCAAGCTTAATAGGATACTCCTTA
A
C
C
C
T
A
C
G
A
C
C
A
A
G
C
T
T
A
A
T
A
G
G
A
T
A
C
T
C
C
T
T
A
Genes: KD95OFCAJNF

Composition

Yorkshire Terrier
18%
Maltese
9%
Beagle
9%
French Bulldog
9%
Labrador
9%
Corgi
9%
Schnauzer
9%
Dachshund
9%
Border Collie
9%
Pitbull terrier
9%

Current Energy

Vitality -48 points
Lunar Effect -6 points

Traits Breakdown

Body Maltese
Tail Beagle
Legs French Bulldog
Front Legs Labrador
Head Corgi
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Dachshund
Nose Border Collie
Eyes Pitbull terrier
Color Yorkshire Terrier