Bruce Bridgett Litecoin Dog - Mix of Boxer, Labrador BK, French Bulldog, Beagle, Labrador, Husky, Shiba Inu and Poodle

Achievements

None
Bruce Bridgett
Hey there... I'm Bruce Bridgett. When my human brushes my coat, I get frisky! I hate hiding under the bed during a thunder storm but that's just smart, right? I love cuddling up, doggy-style after a romantic evening. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title!
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACGCAGCACTACCAAACACACGAGTAGACCGA
A
A
C
G
C
A
G
C
A
C
T
A
C
C
A
A
A
C
A
C
A
C
G
A
G
T
A
G
A
C
C
G
A
Genes: G66D5G49EI9

Composition

Boxer
18%
Labrador BK
18%
French Bulldog
18%
Beagle
9%
Labrador
9%
Husky
9%
Shiba Inu
9%
Poodle
9%

Current Energy

Vitality -32 points
Lunar Effect -2 points

Traits Breakdown

Body Boxer
Tail Labrador BK
Legs Labrador BK
Front Legs Beagle
Head Labrador
Ears Boxer
Snout Husky
Mouth French Bulldog
Nose Shiba Inu
Eyes Poodle
Color French Bulldog

Parents

No Children