Martha Mal Cryptocurrency Game Dog - Mix of Grey Wolf, Golder Retriever, Husky, Shiba Inu, French Bulldog, Labrador, St. Bernard, Rottweiler and Border Collie

Achievements

None
Martha Mal
Yo dog! Martha Mal here. I'm into leather...if I have the right partner. My favorite treat is to steal the pepperoni off of pizza. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! I just want a snuggle buddy with a nice, soft coat.
  • Purity 5%
  • Age 4 months
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCACAGTAAGAAGACGACCATGACACCCCTAC
C
C
C
A
C
A
G
T
A
A
G
A
A
G
A
C
G
A
C
C
A
T
G
A
C
A
C
C
C
C
T
A
C
Genes: L4E8895BHLJ

Composition

Grey Wolf
18%
Golder Retriever
18%
Husky
9%
Shiba Inu
9%
French Bulldog
9%
Labrador
9%
St. Bernard
9%
Rottweiler
9%
Border Collie
9%

Current Energy

Vitality -34 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail Husky
Legs Shiba Inu
Front Legs Golder Retriever
Head Golder Retriever
Ears French Bulldog
Snout Labrador
Mouth St. Bernard
Nose Rottweiler
Eyes Grey Wolf
Color Border Collie

Parents

No Children