Adelaide Aries Crypto Game Dog - Mix of Labrador, Golder Retriever, French Bulldog, Maltese and St. Bernard

Achievements

None
Adelaide Aries
I'm Adelaide Aries and I'd like to show you a trick or two. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. In my humble opinion the best toy is one of my human's stinky, old socks. I enjoy destroying a nice fresh pair of slippers.
  • Purity 40%
  • Age 2 months
  • Racing Exp 0
  • Labrador 64%
  • 0 races
  • Gen 21
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACCACCACCACCAAGACCACCACGAACCTGA
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
A
G
A
C
C
A
C
C
A
C
G
A
A
C
C
T
G
A
Genes: 555558559KB

Composition

Labrador
64%
Golder Retriever
9%
French Bulldog
9%
Maltese
9%
St. Bernard
9%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose French Bulldog
Eyes Maltese
Color St. Bernard