Quby Quby Bitcoin Dog - Mix of Labrador, Grey Wolf, Golder Retriever, Beagle, Boxer, Maltese and St. Bernard

Achievements

Racer
Quby Quby
I live life by my favorite quote "Every dog has it's day", but every day is my day! I may need de-worming. I'm totally against baths! They are the worst! I like it when you're frisky.
  • Purity 18%
  • Age 3 months
  • Racing Exp 1
  • Labrador 45%
  • 1 races
  • Gen 20
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.65 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACCACCACCCCCAAGACTACCAAACACCTGA
C
C
A
C
C
A
C
C
A
C
C
C
C
C
A
A
G
A
C
T
A
C
C
A
A
A
C
A
C
C
T
G
A
Genes: 555L58D5GKB

Composition

Labrador
45%
Grey Wolf
9%
Golder Retriever
9%
Beagle
9%
Boxer
9%
Maltese
9%
St. Bernard
9%

Current Energy

Vitality -11 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Grey Wolf
Head Labrador
Ears Golder Retriever
Snout Beagle
Mouth Labrador
Nose Boxer
Eyes Maltese
Color St. Bernard