Millie Marshmallow Litecoin Game Dog - Mix of Pug, Yorkshire Terrier, Maltese, Boxer, Labrador BK, Beagle and Husky

Achievements

None
Millie Marshmallow
What's your favorite bed? Mine is the dirty laundry. Long or short hair works for me, just no baldies please. My female human wears crotchless undies, but she doesn't like the ones I make for her! I'm not looking to hook up forever, just to have a little fun.
  • Purity 9%
  • Age 4 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 14
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAATTATTAGAAACCACCAACGCACTAAACACA
G
A
A
T
T
A
T
T
A
G
A
A
A
C
C
A
C
C
A
A
C
G
C
A
C
T
A
A
A
C
A
C
A
Genes: 2FF2KKG6DG4

Composition

Pug
18%
Yorkshire Terrier
18%
Maltese
18%
Boxer
18%
Labrador BK
9%
Beagle
9%
Husky
9%

Current Energy

Vitality -60 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs Pug
Head Maltese
Ears Maltese
Snout Boxer
Mouth Labrador BK
Nose Beagle
Eyes Boxer
Color Husky