Mason May Cryptocurrency Dog - Mix of Labrador, Yorkshire Terrier, Shiba Inu, Corgi, Golder Retriever, Boxer and French Bulldog

Achievements

None
Mason May
It turns me on when I can show an older dog a new trick. I enjoy crunchy kibble and drinking from toilets. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I'm totally against baths! They are the worst!
  • Purity 7%
  • Age 2 months
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 8
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCATTACCAAGCGTATTAGTAAGACCAAACCGA
C
C
A
T
T
A
C
C
A
A
G
C
G
T
A
T
T
A
G
T
A
A
G
A
C
C
A
A
A
C
C
G
A
Genes: 5F5OEFE85G9

Composition

Labrador
27%
Yorkshire Terrier
18%
Shiba Inu
18%
Corgi
9%
Golder Retriever
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -2 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador
Tail Yorkshire Terrier
Legs Labrador
Front Legs Corgi
Head Shiba Inu
Ears Yorkshire Terrier
Snout Shiba Inu
Mouth Golder Retriever
Nose Labrador
Eyes Boxer
Color French Bulldog