Paddy Punkin Litecoin Dog - Mix of Husky, Yorkshire Terrier, Border Collie, German Shepard, Schnauzer, Grey Wolf, Pug, Poodle and Golder Retriever

Achievements

None
Paddy Punkin
I keep my well-built figure with zeros and ones. I really dislike stinky flea collars. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! If I can't reach it to clean it myself, it doesn't need cleaning! My human says I'm loyal, intelligent, devoted and affectionate.
  • Purity 6%
  • Age 4 months
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTATACTCAATACCCACAGAAGACAGAACA
A
C
A
T
T
A
T
A
C
T
C
A
A
T
A
C
C
C
A
C
A
G
A
A
G
A
C
A
G
A
A
C
A
Genes: 4FJ7CL42I84

Composition

Husky
27%
Yorkshire Terrier
9%
Border Collie
9%
German Shepard
9%
Schnauzer
9%
Grey Wolf
9%
Pug
9%
Poodle
9%
Golder Retriever
9%

Current Energy

Vitality -18 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs Border Collie
Front Legs German Shepard
Head Schnauzer
Ears Grey Wolf
Snout Husky
Mouth Pug
Nose Poodle
Eyes Golder Retriever
Color Husky

Parents

No Children