Carly Charlie Brown Crypto Game Dog - Mix of Shiba Inu, Golder Retriever, Maltese, French Bulldog, Border Collie, Beagle and St. Bernard

Achievements

None
Carly Charlie Brown
Carly Charlie Brown is the name, love is my game. And fetch of course... The cloud's my neighborhood. Halloween costumes are the worst, I hate 'em! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I want someone who can show me a good time; I'll do the same for you.
  • Purity 11%
  • Age 4 months
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACGATACAGAACCACCAGACTAGTATGAGTA
G
T
A
C
G
A
T
A
C
A
G
A
A
C
C
A
C
C
A
G
A
C
T
A
G
T
A
T
G
A
G
T
A
Genes: E9J8KK8DEBE

Composition

Shiba Inu
27%
Golder Retriever
18%
Maltese
18%
French Bulldog
9%
Border Collie
9%
Beagle
9%
St. Bernard
9%

Current Energy

Vitality -19 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail French Bulldog
Legs Border Collie
Front Legs Golder Retriever
Head Maltese
Ears Maltese
Snout Golder Retriever
Mouth Beagle
Nose Shiba Inu
Eyes St. Bernard
Color Shiba Inu