Vegas Velvet Digital Cryptocurrency Game Dog - Mix of Labrador, St. Bernard, Beagle, Labrador BK, Grey Wolf, Rottweiler, Schnauzer and French Bulldog

Achievements

None
Vegas Velvet
The internet's my home. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. My favorite way to relax is to be scratched on my belly. Too much steak gives me the runs! I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect!
  • Purity 4%
  • Age 4 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGCACCACCCTGACACCTAATACGACTATGA
C
C
A
G
C
A
C
C
A
C
C
C
T
G
A
C
A
C
C
T
A
A
T
A
C
G
A
C
T
A
T
G
A
Genes: 565LBHDC9DB

Composition

Labrador
18%
St. Bernard
18%
Beagle
18%
Labrador BK
9%
Grey Wolf
9%
Rottweiler
9%
Schnauzer
9%
French Bulldog
9%

Current Energy

Vitality -1 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador
Tail Labrador BK
Legs Labrador
Front Legs Grey Wolf
Head St. Bernard
Ears Rottweiler
Snout Beagle
Mouth Schnauzer
Nose French Bulldog
Eyes Beagle
Color St. Bernard