Trudy Tardis Litecoin Dog - Mix of Golder Retriever, St. Bernard, Husky, Boxer, Dachshund, Rottweiler and Beagle

Achievements

Podium Champion
Pro Racer
Speed Champion
TOP 10 Fastest
Trudy Tardis
Let me introduce myself, I'm Trudy Tardis. I don't appreciate being around bores who bark too much. I think hamsters and cats are both over-rated. I like to play fetch with a tennis ball. I love car rides when I can stick my head out the window. I just want to "share a bone"... ;)
  • Purity 11%
  • Age 4 months
  • Racing Exp 65
  • Golder Retriever 27%
  • 14 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 4 3 1
 Best Time13.92 sec
Rank 2  Racing *** Coins
57.1 % wins (8) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATGAACATGAAACACAGGACACCTAAGAAGA
A
G
A
T
G
A
A
C
A
T
G
A
A
A
C
A
C
A
G
G
A
C
A
C
C
T
A
A
G
A
A
G
A
Genes: 8B4BG4AHD88

Composition

Golder Retriever
27%
St. Bernard
18%
Husky
18%
Boxer
9%
Dachshund
9%
Rottweiler
9%
Beagle
9%

Current Energy

Vitality -32 points
Lunar Effect +8 points

Traits Breakdown

Body Golder Retriever
Tail St. Bernard
Legs Husky
Front Legs St. Bernard
Head Boxer
Ears Husky
Snout Dachshund
Mouth Rottweiler
Nose Beagle
Eyes Golder Retriever
Color Golder Retriever