Birdo Balthier Crypto Dog - Mix of Shiba Inu, Golder Retriever, French Bulldog, Border Collie, Maltese, Rottweiler, Labrador, Yorkshire Terrier and St. Bernard

Achievements

Racer
Podium Champion
Birdo Balthier
What's up, dog? I'm Birdo Balthier! I hate it when my human runs out of poop-bags. How embarrassing! I love car rides when I can stick my head out the window. I'm always up for a nice long walk around the neighborhood. I just want a snuggle buddy with a nice, soft coat.
  • Purity 5%
  • Age 2 months
  • Racing Exp 65
  • Shiba Inu 18%
  • 19 races
  • Gen 1
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 1 4 3
19 races    Best Time14.02 sec
No rank  Racing *** Coins
42.1 % wins (8) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACGATACAGAACCCACAGACCATTATGAGTA
G
T
A
C
G
A
T
A
C
A
G
A
A
C
C
C
A
C
A
G
A
C
C
A
T
T
A
T
G
A
G
T
A
Genes: E9J8KH85FBE

Composition

Shiba Inu
18%
Golder Retriever
18%
French Bulldog
9%
Border Collie
9%
Maltese
9%
Rottweiler
9%
Labrador
9%
Yorkshire Terrier
9%
St. Bernard
9%

Current Energy

Vitality +1 points
Lunar Effect +10 points

Traits Breakdown

Body Shiba Inu
Tail French Bulldog
Legs Border Collie
Front Legs Golder Retriever
Head Maltese
Ears Rottweiler
Snout Golder Retriever
Mouth Labrador
Nose Yorkshire Terrier
Eyes St. Bernard
Color Shiba Inu