Lark Liberty Litecoin Dog - Mix of Boxer, Maltese, Labrador, Labrador BK, Beagle, Golder Retriever, Rottweiler and German Shepard

Achievements

Racer
Lark Liberty
I live in cyberspace where you can turn me on. Creativity is my middle name... I turn everything in to a chew toy. I cry whenever I hear an ambulance siren! I hate bubble baths; mud puddles are more my style. If you enjoy growling through fences as much as I do, we should get together.
  • Purity 4%
  • Age 10 months
  • Racing Exp 7
  • Boxer 18%
  • 2 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 1
 Best Time16.30 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAACACCCCACTAAGACACCCAACCTCAAAC
G
C
A
A
A
C
A
C
C
C
C
A
C
T
A
A
G
A
C
A
C
C
C
A
A
C
C
T
C
A
A
A
C
Genes: 6GK5D8H5K7G

Composition

Boxer
18%
Maltese
18%
Labrador
18%
Labrador BK
9%
Beagle
9%
Golder Retriever
9%
Rottweiler
9%
German Shepard
9%

Current Energy

Vitality -41 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador BK
Tail Boxer
Legs Maltese
Front Legs Labrador
Head Beagle
Ears Golder Retriever
Snout Rottweiler
Mouth Labrador
Nose Maltese
Eyes German Shepard
Color Boxer