Gen Gigi Litecoin Dog - Mix of German Shepard, Border Collie, Dachshund, Grey Wolf, Yorkshire Terrier and Labrador BK

Achievements

None
Gen Gigi
Hi, I'm Gen Gigi. I work in The Virtual Machine. They say my bite is worse than my bark. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I don't like having to stay off the furniture. I need someone that "brings home the bacon"!
  • Purity 14%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATACCCCTTAGGAGGAGCATACTCATAC
T
C
A
T
C
A
T
A
C
C
C
C
T
T
A
G
G
A
G
G
A
G
C
A
T
A
C
T
C
A
T
A
C
Genes: 77JLFAA6J7J

Composition

German Shepard
27%
Border Collie
27%
Dachshund
18%
Grey Wolf
9%
Yorkshire Terrier
9%
Labrador BK
9%

Current Energy

Vitality +7 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Border Collie
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Dachshund
Snout Dachshund
Mouth Labrador BK
Nose Border Collie
Eyes German Shepard
Color Border Collie

Parents

No Children