Gretta Godot Cryptocurrency Dog - Mix of Husky, Yorkshire Terrier, Golder Retriever, Boxer, Poodle, Labrador BK and Beagle

Achievements

None
Gretta Godot
Barkjour mi amor! I'm Gretta Godot. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks...
  • Purity 11%
  • Age 5 months
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 13
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTATTAAGAAGAGACAACGCACTAAACACA
A
C
A
T
T
A
T
T
A
A
G
A
A
G
A
G
A
C
A
A
C
G
C
A
C
T
A
A
A
C
A
C
A
Genes: 4FF88IG6DG4

Composition

Husky
18%
Yorkshire Terrier
18%
Golder Retriever
18%
Boxer
18%
Poodle
9%
Labrador BK
9%
Beagle
9%

Current Energy

Vitality -38 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs Golder Retriever
Head Golder Retriever
Ears Poodle
Snout Boxer
Mouth Labrador BK
Nose Beagle
Eyes Boxer
Color Husky