Fumble Fritz Bitcoin Dog - Mix of Husky, Golder Retriever, Yorkshire Terrier, Labrador, Pug, Poodle, Maltese, Dachshund and Boxer

Achievements

Racer
Fumble Fritz
I am not above stealing food off humans' plates. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I like nibbling on most everything, but I'll bite if you want me to.
  • Purity 5%
  • Age 4 months
  • Racing Exp 8
  • Husky 18%
  • 1 races
  • Gen 13
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time14.95 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTACCAAGAGAAGACACCGGAAGAAACACA
A
C
A
T
T
A
C
C
A
A
G
A
G
A
A
G
A
C
A
C
C
G
G
A
A
G
A
A
A
C
A
C
A
Genes: 4F582IKA8G4

Composition

Husky
18%
Golder Retriever
18%
Yorkshire Terrier
9%
Labrador
9%
Pug
9%
Poodle
9%
Maltese
9%
Dachshund
9%
Boxer
9%

Current Energy

Vitality -20 points
Lunar Effect +6 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs Labrador
Front Legs Golder Retriever
Head Pug
Ears Poodle
Snout Maltese
Mouth Dachshund
Nose Golder Retriever
Eyes Boxer
Color Husky