Keesha Kano Cryptocurrency Game Dog - Mix of Husky, Corgi, Border Collie, Grey Wolf, Boxer, St. Bernard, Maltese, Rottweiler, Golder Retriever and German Shepard

Achievements

None
Keesha Kano
Hello, I be Keesha Kano. I'd like to take you for a byte to eat in cyberspace. My female human wears crotchless undies, but she doesn't like the ones I make for her! Are you into garbage cans? I am. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm looking for a good Tug-O-War partner.
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCACATACCCCAACTGAACCCACAGATCAACA
A
G
C
A
C
A
T
A
C
C
C
C
A
A
C
T
G
A
A
C
C
C
A
C
A
G
A
T
C
A
A
C
A
Genes: O4JLGBKH874

Composition

Husky
18%
Corgi
9%
Border Collie
9%
Grey Wolf
9%
Boxer
9%
St. Bernard
9%
Maltese
9%
Rottweiler
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -20 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Husky
Legs Border Collie
Front Legs Grey Wolf
Head Boxer
Ears St. Bernard
Snout Maltese
Mouth Rottweiler
Nose Golder Retriever
Eyes German Shepard
Color Husky