Ryder Rain Delay Crypto Dog - Mix of Grey Wolf, Golder Retriever, Maltese, Border Collie, St. Bernard, Beagle, Yorkshire Terrier and Husky

Achievements

Racer
Ryder Rain Delay
I hate it when humans put the lid down. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I'm always up for some puppy action, is that wrong? I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers.
  • Purity 11%
  • Age 4 months
  • Racing Exp 1
  • Grey Wolf 36%
  • 1 races
  • Gen 11
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.23 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCAGACCCCCCACCTACTGACTATTACCCACA
C
C
C
A
G
A
C
C
C
C
C
C
A
C
C
T
A
C
T
G
A
C
T
A
T
T
A
C
C
C
A
C
A
Genes: L8LLKJBDFL4

Composition

Grey Wolf
36%
Golder Retriever
9%
Maltese
9%
Border Collie
9%
St. Bernard
9%
Beagle
9%
Yorkshire Terrier
9%
Husky
9%

Current Energy

Vitality -10 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs Grey Wolf
Front Legs Grey Wolf
Head Maltese
Ears Border Collie
Snout St. Bernard
Mouth Beagle
Nose Yorkshire Terrier
Eyes Grey Wolf
Color Husky