Corky Cutie Litecoin Dog - Mix of Border Collie, Pitbull terrier, Pug, Husky, Beagle, Labrador, Maltese and Rottweiler

Achievements

None
Corky Cutie
I am a proud show dog. I like showing off my perfect coat! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I want someone who can show me a good time; I'll do the same for you.
  • Purity 8%
  • Age 12 months
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAAACACTATACTACTCCCCATCCACCCAC
T
A
C
G
A
A
A
C
A
C
T
A
T
A
C
T
A
C
T
C
C
C
C
A
T
C
C
A
C
C
C
A
C
Genes: J24DJJN5NKH

Composition

Border Collie
27%
Pitbull terrier
18%
Pug
9%
Husky
9%
Beagle
9%
Labrador
9%
Maltese
9%
Rottweiler
9%

Current Energy

Vitality -24 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Husky
Front Legs Beagle
Head Border Collie
Ears Border Collie
Snout Pitbull terrier
Mouth Labrador
Nose Pitbull terrier
Eyes Maltese
Color Rottweiler