Bean Brittany Litecoin Dog - Mix of Yorkshire Terrier, Husky, Border Collie, Rottweiler, St. Bernard, Pug and Poodle

Achievements

None
Bean Brittany
Watching kids play without me is the worst, no? I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I'm a serial monogamist. I enjoy crunchy kibble and drinking from toilets. I've been solitary dog...looking for someone worth changing over.
  • Purity 11%
  • Age 12 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTATTAACATACTACACATGAGAAGACCACCAC
T
T
A
T
T
A
A
C
A
T
A
C
T
A
C
A
C
A
T
G
A
G
A
A
G
A
C
C
A
C
C
A
C
Genes: FF4JJ4B2IHH

Composition

Yorkshire Terrier
18%
Husky
18%
Border Collie
18%
Rottweiler
18%
St. Bernard
9%
Pug
9%
Poodle
9%

Current Energy

Vitality -13 points
Lunar Effect +6 points

Traits Breakdown

Body Yorkshire Terrier
Tail Yorkshire Terrier
Legs Husky
Front Legs Border Collie
Head Border Collie
Ears Husky
Snout St. Bernard
Mouth Pug
Nose Poodle
Eyes Rottweiler
Color Rottweiler