Kona King Crypto Dog - Mix of Boxer, Rottweiler, Husky, Beagle, Pitbull terrier, Labrador BK and Corgi

Achievements

None
Kona King
You can call me Kona King, everybody else does. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I enjoy going to the dog park to see all my friends! I'm not looking to hook up forever, just to have a little fun.
  • Purity 11%
  • Age 4 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATCCAACAACAACCACACAGCACACAGCACA
C
T
A
T
C
C
A
A
C
A
A
C
A
A
C
C
A
C
A
C
A
G
C
A
C
A
C
A
G
C
A
C
A
Genes: DNGGGH46HO4

Composition

Boxer
27%
Rottweiler
18%
Husky
18%
Beagle
9%
Pitbull terrier
9%
Labrador BK
9%
Corgi
9%

Current Energy

Vitality -40 points
Lunar Effect -6 points

Traits Breakdown

Body Beagle
Tail Pitbull terrier
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Rottweiler
Snout Husky
Mouth Labrador BK
Nose Rottweiler
Eyes Corgi
Color Husky