Nemo Neo Crypto Dog - Mix of Pug, Boxer, Poodle, Yorkshire Terrier, St. Bernard, Golder Retriever, Border Collie, Labrador BK and Husky

Achievements

None
Nemo Neo
Nemo Neo here. Wanna play? My AI may be artificial, but at least I'm intelligent. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I live life by my favorite quote "Every dog has it's day", but every day is my day! I'm just looking for some puppy love.
  • Purity 5%
  • Age 4 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 13
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGACTTATGAAGATACAACGCAACAAACGAA
G
A
A
G
A
C
T
T
A
T
G
A
A
G
A
T
A
C
A
A
C
G
C
A
A
C
A
A
A
C
G
A
A
Genes: 2IFB8JG64G2

Composition

Pug
18%
Boxer
18%
Poodle
9%
Yorkshire Terrier
9%
St. Bernard
9%
Golder Retriever
9%
Border Collie
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -58 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Poodle
Legs Yorkshire Terrier
Front Legs St. Bernard
Head Golder Retriever
Ears Border Collie
Snout Boxer
Mouth Labrador BK
Nose Husky
Eyes Boxer
Color Pug