Midna Moki Crypto Dog - Mix of Corgi, Grey Wolf, St. Bernard, Pug, German Shepard, Maltese, Rottweiler and Pitbull terrier

Achievements

None
Midna Moki
I'm all about a hard drive because you can't do anything with a floppy disc. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I like to play fetch with a tennis ball. I'm looking for someone to make bath time a little more bearable!
  • Purity 4%
  • Age 4 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCGAAAGCCCCTCAACCTGACACCCCTGATCC
A
G
C
G
A
A
A
G
C
C
C
C
T
C
A
A
C
C
T
G
A
C
A
C
C
C
C
T
G
A
T
C
C
Genes: O2OL7KBHLBN

Composition

Corgi
18%
Grey Wolf
18%
St. Bernard
18%
Pug
9%
German Shepard
9%
Maltese
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality -18 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Pug
Legs Corgi
Front Legs Grey Wolf
Head German Shepard
Ears Maltese
Snout St. Bernard
Mouth Rottweiler
Nose Grey Wolf
Eyes St. Bernard
Color Pitbull terrier