Ackbar Ashes Crypto Dog - Mix of Labrador, Shiba Inu, Rottweiler, Yorkshire Terrier, Border Collie, Husky, St. Bernard and Boxer

Achievements

None
Ackbar Ashes
I hate having to share my food dish... I enjoy destroying a nice fresh pair of slippers. Hound Dog by Elvis is probably the best song ever written. The smell of fresh manure to roll in makes me wild.
  • Purity 4%
  • Age 4 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCATTACCATACGTAACATGACACAACCACGTA
C
C
A
T
T
A
C
C
A
T
A
C
G
T
A
A
C
A
T
G
A
C
A
C
A
A
C
C
A
C
G
T
A
Genes: 5F5JE4BHGHE

Composition

Labrador
18%
Shiba Inu
18%
Rottweiler
18%
Yorkshire Terrier
9%
Border Collie
9%
Husky
9%
St. Bernard
9%
Boxer
9%

Current Energy

Vitality -7 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Yorkshire Terrier
Legs Labrador
Front Legs Border Collie
Head Shiba Inu
Ears Husky
Snout St. Bernard
Mouth Rottweiler
Nose Boxer
Eyes Rottweiler
Color Shiba Inu

Parents

No Children