Olympus Olympus Crypto Dog - Mix of Corgi, French Bulldog, Beagle, Yorkshire Terrier, Labrador, Grey Wolf, Pug, St. Bernard and German Shepard

Achievements

None
Olympus Olympus
Suh...you good? Olympus Olympus here. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 3%
  • Age 5 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCCTATTACCACCCAGCGAATGACGATCACGA
A
G
C
C
T
A
T
T
A
C
C
A
C
C
C
A
G
C
G
A
A
T
G
A
C
G
A
T
C
A
C
G
A
Genes: ODF5LO2B979

Composition

Corgi
18%
French Bulldog
18%
Beagle
9%
Yorkshire Terrier
9%
Labrador
9%
Grey Wolf
9%
Pug
9%
St. Bernard
9%
German Shepard
9%

Current Energy

Vitality -38 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Beagle
Legs Yorkshire Terrier
Front Legs Labrador
Head Grey Wolf
Ears Corgi
Snout Pug
Mouth St. Bernard
Nose French Bulldog
Eyes German Shepard
Color French Bulldog