Mercy Maddux Bitcoin Dog - Mix of Pitbull terrier, Maltese, Labrador, Dachshund, Beagle, Grey Wolf, Poodle and Labrador BK

Achievements

None
Mercy Maddux
Rolling around on the carpet after a bath is my favorite way to dry. I may need de-worming. Small yappy creatures bug me...they disturb my zen. I love connecting with my friends via pee-mail.
  • Purity 8%
  • Age 12 months
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCCCAGGATCCCTACCCGACGCATCCACCACC
T
C
C
C
C
A
G
G
A
T
C
C
C
T
A
C
C
C
G
A
C
G
C
A
T
C
C
A
C
C
A
C
C
Genes: N5ANDLI6NKK

Composition

Pitbull terrier
27%
Maltese
18%
Labrador
9%
Dachshund
9%
Beagle
9%
Grey Wolf
9%
Poodle
9%
Labrador BK
9%

Current Energy

Vitality -56 points
Lunar Effect -14 points

Traits Breakdown

Body Pitbull terrier
Tail Labrador
Legs Dachshund
Front Legs Pitbull terrier
Head Beagle
Ears Grey Wolf
Snout Poodle
Mouth Labrador BK
Nose Pitbull terrier
Eyes Maltese
Color Maltese