Little Bit Liam Crypto Game Dog - Mix of Grey Wolf, Pitbull terrier, Labrador BK, Maltese, Dachshund and Shiba Inu

Achievements

None
Little Bit Liam
Greetings. My name is Little Bit Liam. Have you ever dated a digital creation before? I live life by my favorite quote "Every dog has it's day", but every day is my day! You know the worst? Watching my humans 'get it on' when I've got no one. I just want to "share a bone"... ;)
  • Purity 14%
  • Age 12 months
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTCCGGACCCGTACCCGCAGCACCCACCACC
T
C
C
T
C
C
G
G
A
C
C
C
G
T
A
C
C
C
G
C
A
G
C
A
C
C
C
A
C
C
A
C
C
Genes: NNALEL66LKK

Composition

Grey Wolf
27%
Pitbull terrier
18%
Labrador BK
18%
Maltese
18%
Dachshund
9%
Shiba Inu
9%

Current Energy

Vitality -34 points
Lunar Effect -14 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Dachshund
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Labrador BK
Mouth Labrador BK
Nose Grey Wolf
Eyes Maltese
Color Maltese