Jezebel Joan Of Arc Bitcoin Dog - Mix of Pitbull terrier, Grey Wolf, Dachshund, Beagle, Poodle, Maltese and Corgi

Achievements

None
Jezebel Joan Of Arc
As a digital dog, let me say Bob Dole did not invent the internet. I am a proud show dog. I like showing off my perfect coat! Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 12%
  • Age 12 months
  • Racing Exp 0
  • Pitbull terrier 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTCCGGATCCCTACCCGACCCCTCCACCAGC
T
C
C
T
C
C
G
G
A
T
C
C
C
T
A
C
C
C
G
A
C
C
C
C
T
C
C
A
C
C
A
G
C
Genes: NNANDLILNKO

Composition

Pitbull terrier
36%
Grey Wolf
18%
Dachshund
9%
Beagle
9%
Poodle
9%
Maltese
9%
Corgi
9%

Current Energy

Vitality -56 points
Lunar Effect -14 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Dachshund
Front Legs Pitbull terrier
Head Beagle
Ears Grey Wolf
Snout Poodle
Mouth Grey Wolf
Nose Pitbull terrier
Eyes Maltese
Color Corgi