Patch Phantom Cryptocurrency Dog - Mix of Shiba Inu, Labrador BK, Pug, Yorkshire Terrier, Boxer, Beagle, Labrador and Husky

Achievements

None
Patch Phantom
How do you do? I'm Patch Phantom. I run with a pack in the data warehouse. Long or short hair works for me, just no baldies please. I cry whenever I hear an ambulance siren! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGAAGTATTAGTAGCAGCAAACCTACCAACA
G
T
A
G
A
A
G
T
A
T
T
A
G
T
A
G
C
A
G
C
A
A
A
C
C
T
A
C
C
A
A
C
A
Genes: E2EFE66GD54

Composition

Shiba Inu
27%
Labrador BK
18%
Pug
9%
Yorkshire Terrier
9%
Boxer
9%
Beagle
9%
Labrador
9%
Husky
9%

Current Energy

Vitality -35 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Pug
Legs Shiba Inu
Front Legs Yorkshire Terrier
Head Shiba Inu
Ears Labrador BK
Snout Labrador BK
Mouth Boxer
Nose Beagle
Eyes Labrador
Color Husky