Binx Bonnie Digital Cryptocurrency Dog - Mix of Labrador, Poodle, Shiba Inu, Boxer, Grey Wolf, Beagle and St. Bernard

Achievements

Speed Champion
Pro Racer
Podium Champion
Master Champion
Binx Bonnie
Taking a break from chasing Nyan Cat around cyberspace. I'm going kill that damn Nyan Cat if I can catch it. I live life by my favorite quote "Every dog has it's day", but every day is my day! I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 9%
  • Age 2 months
  • Racing Exp 132
  • Labrador 18%
  • 30 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 9 4 3
30 races    Best Time13.92 sec
No rank  Racing *** Coins
53.3 % wins (16) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGACCCACCCGTAGTACTAGACAACAACTGA
C
C
A
G
A
C
C
C
A
C
C
C
G
T
A
G
T
A
C
T
A
G
A
C
A
A
C
A
A
C
T
G
A
Genes: 5I5LEEDIGGB

Composition

Labrador
18%
Poodle
18%
Shiba Inu
18%
Boxer
18%
Grey Wolf
9%
Beagle
9%
St. Bernard
9%

Current Energy

Vitality +14 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Poodle
Legs Labrador
Front Legs Grey Wolf
Head Shiba Inu
Ears Shiba Inu
Snout Beagle
Mouth Poodle
Nose Boxer
Eyes Boxer
Color St. Bernard