Snowy Spunky Litecoin Game Dog - Mix of Boxer, St. Bernard, Dachshund, German Shepard, Pitbull terrier, Beagle, Maltese, Rottweiler and Border Collie

Achievements

None
Snowy Spunky
Hullo. My name is Snowy Spunky. I don't like it when my bowl is empty, so I take it to my human and it magically refills! Sometimes I forget where I buried my bone. Rolling around on the carpet after a bath is my favorite way to dry. After introductory sniffing, I like some licking.
  • Purity 4%
  • Age 4 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAGGATCATCCCTAAACACCAACCACTACAAC
T
G
A
G
G
A
T
C
A
T
C
C
C
T
A
A
A
C
A
C
C
A
A
C
C
A
C
T
A
C
A
A
C
Genes: BA7NDGKGHJG

Composition

Boxer
27%
St. Bernard
9%
Dachshund
9%
German Shepard
9%
Pitbull terrier
9%
Beagle
9%
Maltese
9%
Rottweiler
9%
Border Collie
9%

Current Energy

Vitality -33 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Dachshund
Legs German Shepard
Front Legs Pitbull terrier
Head Beagle
Ears Boxer
Snout Maltese
Mouth Boxer
Nose Rottweiler
Eyes Border Collie
Color Boxer