Dinky Dunn Bitcoin Dog - Mix of Corgi, Maltese, Labrador, Husky, Labrador BK, Pitbull terrier and French Bulldog

Achievements

None
Dinky Dunn
Hello, I'm Dinky Dunn. How's it goin'? I live in cyberspace where you can turn me on. Little Bow Wow is my favorite musician. I just assume he's a dog... I think hamsters and cats are both over-rated. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff.
  • Purity 12%
  • Age 4 months
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAAGCACAACCACCACCGCAAGCTCCCGAAGC
C
C
A
A
G
C
A
C
A
A
C
C
A
C
C
A
C
C
G
C
A
A
G
C
T
C
C
C
G
A
A
G
C
Genes: 5O4KKK6ON9O

Composition

Corgi
27%
Maltese
27%
Labrador
9%
Husky
9%
Labrador BK
9%
Pitbull terrier
9%
French Bulldog
9%

Current Energy

Vitality -31 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Corgi
Legs Husky
Front Legs Maltese
Head Maltese
Ears Maltese
Snout Labrador BK
Mouth Corgi
Nose Pitbull terrier
Eyes French Bulldog
Color Corgi