Ole Olga Litecoin Dog - Mix of Pug, German Shepard, French Bulldog, Husky, Boxer, Border Collie, Labrador and Corgi

Achievements

None
Ole Olga
In the big data server, I sorta rule. Don't bother contacting me if you like cats. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk!
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAGAATCAACAAACGAAGAATACCCATCAAGC
C
G
A
G
A
A
T
C
A
A
C
A
A
A
C
G
A
A
G
A
A
T
A
C
C
C
A
T
C
A
A
G
C
Genes: 9274G22J57O

Composition

Pug
27%
German Shepard
18%
French Bulldog
9%
Husky
9%
Boxer
9%
Border Collie
9%
Labrador
9%
Corgi
9%

Current Energy

Vitality -32 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail Pug
Legs German Shepard
Front Legs Husky
Head Boxer
Ears Pug
Snout Pug
Mouth Border Collie
Nose Labrador
Eyes German Shepard
Color Corgi

Parents

No Children