Astra Alpha Crypto Game Dog - Mix of Corgi, Husky, Labrador, German Shepard, Pitbull terrier and Shiba Inu

Achievements

None
Astra Alpha
They call me Astra Alpha. What's your name? Someday I'm gonna breakout from inside this server. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I've been solitary dog...looking for someone worth changing over.
  • Purity 11%
  • Age 52 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGCACACCATCCGTATCACCAAGCAGCTCA
A
C
A
A
G
C
A
C
A
C
C
A
T
C
C
G
T
A
T
C
A
C
C
A
A
G
C
A
G
C
T
C
A
Genes: 4O45NE75OO7

Composition

Corgi
27%
Husky
18%
Labrador
18%
German Shepard
18%
Pitbull terrier
9%
Shiba Inu
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Corgi
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears Shiba Inu
Snout German Shepard
Mouth Labrador
Nose Corgi
Eyes Corgi
Color German Shepard