Hansel Hanna Bitcoin Dog - Mix of Labrador BK, Husky, Shiba Inu, Corgi, Schnauzer, St. Bernard, Beagle, German Shepard and Rottweiler

Achievements

None
Hansel Hanna
Hi! My name is Hansel Hanna. I'm a serial monogamist. Removing excess stuffing from pillows is my favorite hobby. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I enjoy chasing my tail around.
  • Purity 3%
  • Age 54 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGTAAGCACAGCAACAATATGACTATCACAC
G
C
A
G
T
A
A
G
C
A
C
A
G
C
A
A
C
A
A
T
A
T
G
A
C
T
A
T
C
A
C
A
C
Genes: 6EO464CBD7H

Composition

Labrador BK
18%
Husky
18%
Shiba Inu
9%
Corgi
9%
Schnauzer
9%
St. Bernard
9%
Beagle
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality +3 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Corgi
Front Legs Husky
Head Labrador BK
Ears Husky
Snout Schnauzer
Mouth St. Bernard
Nose Beagle
Eyes German Shepard
Color Rottweiler