Boots Big Red Crypto Dog - Mix of German Shepard, Pitbull terrier, Husky, Golder Retriever, Shiba Inu, Rottweiler, Pug, Labrador BK and Border Collie

Achievements

None
Boots Big Red
Top o' the mornin' to ya! I'm Boots Big Red. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. My favorite sport is catching treats my human throws! I'll lick anything. I like exploring off leash best.
  • Purity 3%
  • Age 54 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 5
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCCACAAGATCCTCAGTACACGAAGCATAC
T
C
A
T
C
C
A
C
A
A
G
A
T
C
C
T
C
A
G
T
A
C
A
C
G
A
A
G
C
A
T
A
C
Genes: 7N48N7EH26J

Composition

German Shepard
18%
Pitbull terrier
18%
Husky
9%
Golder Retriever
9%
Shiba Inu
9%
Rottweiler
9%
Pug
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality +10 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail Pitbull terrier
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Shiba Inu
Mouth Rottweiler
Nose Pug
Eyes Labrador BK
Color Border Collie

Parents

No Children