Oakley Old Glory Bitcoin Dog - Mix of German Shepard, Labrador, Poodle, Husky, Pitbull terrier, Corgi, Pug, Labrador BK and Border Collie

Achievements

None
Oakley Old Glory
Oakley Old Glory here, let's shake. Once you go digital, baby, you never go back. Creativity is my middle name... I turn everything in to a chew toy. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 3%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 5
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGACACACCATCCTCAAGCCCAGAAGCATAC
T
C
A
G
A
C
A
C
A
C
C
A
T
C
C
T
C
A
A
G
C
C
C
A
G
A
A
G
C
A
T
A
C
Genes: 7I45N7O526J

Composition

German Shepard
18%
Labrador
18%
Poodle
9%
Husky
9%
Pitbull terrier
9%
Corgi
9%
Pug
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality +16 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Poodle
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears German Shepard
Snout Corgi
Mouth Labrador
Nose Pug
Eyes Labrador BK
Color Border Collie