Rita Rosco Bitcoin Dog - Mix of German Shepard, Poodle, Husky, Golder Retriever, Pitbull terrier, Shiba Inu, Rottweiler, Pug, Labrador BK and Border Collie

Achievements

None
Rita Rosco
If you'd like to get together, I'm Rita Rosco. Nyan Cat is my best friend here in the cyberspace. Creativity is my middle name... I turn everything in to a chew toy. I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 1%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 4
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGACACAAGATCCTCAGTACACGAAGCATAC
T
C
A
G
A
C
A
C
A
A
G
A
T
C
C
T
C
A
G
T
A
C
A
C
G
A
A
G
C
A
T
A
C
Genes: 7I48N7EH26J

Composition

German Shepard
18%
Poodle
9%
Husky
9%
Golder Retriever
9%
Pitbull terrier
9%
Shiba Inu
9%
Rottweiler
9%
Pug
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality +12 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Shiba Inu
Mouth Rottweiler
Nose Pug
Eyes Labrador BK
Color Border Collie