Claire Chips Crypto Dog - Mix of Beagle, Husky, Labrador BK, Shiba Inu, St. Bernard, German Shepard and Rottweiler

Achievements

None
Claire Chips
I live inside of a Virtual machine two steps to the right from the firewall. I hate never catching that damn rabbit in my dreams. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm looking for a good Tug-O-War partner.
  • Purity 11%
  • Age 54 days
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACTAACAACAGTAACACTATGACTATCACAC
G
C
A
C
T
A
A
C
A
A
C
A
G
T
A
A
C
A
C
T
A
T
G
A
C
T
A
T
C
A
C
A
C
Genes: 6D44E4DBD7H

Composition

Beagle
27%
Husky
27%
Labrador BK
9%
Shiba Inu
9%
St. Bernard
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality +20 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Beagle
Legs Husky
Front Legs Husky
Head Shiba Inu
Ears Husky
Snout Beagle
Mouth St. Bernard
Nose Beagle
Eyes German Shepard
Color Rottweiler

Parents

No Children