Cyrano Chamberlain Bitcoin Game Dog - Mix of German Shepard, Husky, Poodle, Corgi, St. Bernard, Labrador BK and Shiba Inu

Achievements

Racer
Cyrano Chamberlain
Hi! I'm Cyrano Chamberlain! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'm going kill that damn Nyan Cat if I can catch it. If you are looking for companionship without commitment, so am I.
  • Purity 11%
  • Age 52 days
  • Racing Exp 20
  • German Shepard 27%
  • 6 races
  • Gen 3
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 0
6 races    Best Time14.75 sec
No rank  Racing *** Coins
33.3 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCAAGCTGAACATCAACAGCAGTAGACGAC
T
C
A
T
C
A
A
G
C
T
G
A
A
C
A
T
C
A
A
C
A
G
C
A
G
T
A
G
A
C
G
A
C
Genes: 77OB4746EII

Composition

German Shepard
27%
Husky
18%
Poodle
18%
Corgi
9%
St. Bernard
9%
Labrador BK
9%
Shiba Inu
9%

Current Energy

Vitality +4 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Corgi
Front Legs St. Bernard
Head Husky
Ears German Shepard
Snout Husky
Mouth Labrador BK
Nose Shiba Inu
Eyes Poodle
Color Poodle