Susie Skipper Crypto Dog - Mix of German Shepard, Pitbull terrier, Poodle, Husky, Golder Retriever, Rottweiler, Pug, Labrador BK and Maltese

Achievements

None
Susie Skipper
Those flying monkeys in the Wizard of Oz still scare me! I could spend days on end chasing my tail. I get so close but it's just so fast! Aggressive dogs that don't let 'me be me' frustrate me. I'm hoping to find someone who'll howl at the moon with me.
  • Purity 3%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGACACAAGATCCTCATCCCACGAAGCAACC
T
C
A
G
A
C
A
C
A
A
G
A
T
C
C
T
C
A
T
C
C
C
A
C
G
A
A
G
C
A
A
C
C
Genes: 7I48N7NH26K

Composition

German Shepard
18%
Pitbull terrier
18%
Poodle
9%
Husky
9%
Golder Retriever
9%
Rottweiler
9%
Pug
9%
Labrador BK
9%
Maltese
9%

Current Energy

Vitality +12 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Pitbull terrier
Mouth Rottweiler
Nose Pug
Eyes Labrador BK
Color Maltese