Barney Bruiser Litecoin Dog - Mix of Husky, Pitbull terrier, Pug, Poodle, Golder Retriever, Shiba Inu, Boxer and Border Collie

Achievements

None
Barney Bruiser
I am a proud show dog. I like showing off my perfect coat! I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 6%
  • Age 54 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACAAGATCCGTATCCGAAGAAAACTAC
A
C
A
G
A
C
A
C
A
A
G
A
T
C
C
G
T
A
T
C
C
G
A
A
G
A
A
A
A
C
T
A
C
Genes: 4I48NEN22GJ

Composition

Husky
18%
Pitbull terrier
18%
Pug
18%
Poodle
9%
Golder Retriever
9%
Shiba Inu
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality +19 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears Shiba Inu
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Boxer
Color Border Collie

Parents

No Children