Colonel Chauncey Crypto Dog - Mix of Husky, St. Bernard, Pug, Beagle, Shiba Inu, Pitbull terrier, Boxer and Border Collie

Achievements

None
Colonel Chauncey
I answer to 'Colonel Chauncey'. I may need de-worming. Rolling around on the carpet after a bath is my favorite way to dry. I love unconditionally. Watching kids play without me is the worst, no?
  • Purity 6%
  • Age 52 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATGAACACTAGTATGATCCGAAGAAAACTAC
A
C
A
T
G
A
A
C
A
C
T
A
G
T
A
T
G
A
T
C
C
G
A
A
G
A
A
A
A
C
T
A
C
Genes: 4B4DEBN22GJ

Composition

Husky
18%
St. Bernard
18%
Pug
18%
Beagle
9%
Shiba Inu
9%
Pitbull terrier
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality +15 points
Lunar Effect +6 points

Traits Breakdown

Body Husky
Tail St. Bernard
Legs Husky
Front Legs Beagle
Head Shiba Inu
Ears St. Bernard
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Boxer
Color Border Collie