Donald Dylan Litecoin Dog - Mix of German Shepard, Border Collie, Poodle, Golder Retriever, Pitbull terrier, Shiba Inu, Maltese, Rottweiler and French Bulldog

Achievements

None
Donald Dylan
Hullo. My name is Donald Dylan. In the big data server, I sorta rule. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I've been looking for love in all the wrong places... Creativity is my middle name... I turn everything in to a chew toy.
  • Purity 3%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATACGACAGATCCTCAGTAACCCACTACCGA
T
C
A
T
A
C
G
A
C
A
G
A
T
C
C
T
C
A
G
T
A
A
C
C
C
A
C
T
A
C
C
G
A
Genes: 7JI8N7EKHJ9

Composition

German Shepard
18%
Border Collie
18%
Poodle
9%
Golder Retriever
9%
Pitbull terrier
9%
Shiba Inu
9%
Maltese
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality +9 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Border Collie
Legs Poodle
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Shiba Inu
Mouth Maltese
Nose Rottweiler
Eyes Border Collie
Color French Bulldog