Goliath Gus Cryptocurrency Game Dog - Mix of Husky, Pug, Shiba Inu, Pitbull terrier, Schnauzer, Boxer and Rottweiler

Achievements

None
Goliath Gus
Sup? ;-) I'm Goliath Gus. Halloween costumes are the worst, I hate 'em! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I pee when I'm excited. My human is my best friend, looking for someone who is okay with that.
  • Purity 14%
  • Age 2 months
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAACAACATCCACAATAGAAGAAAACCAC
A
C
A
G
T
A
A
C
A
A
C
A
T
C
C
A
C
A
A
T
A
G
A
A
G
A
A
A
A
C
C
A
C
Genes: 4E44N4C22GH

Composition

Husky
36%
Pug
18%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality -8 points
Lunar Effect +6 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Schnauzer
Mouth Pug
Nose Pug
Eyes Boxer
Color Rottweiler