Niko Bellic Noodles Virtual Crypto Game Dog - Mix of Yorkshire Terrier, Husky, Labrador BK, Golder Retriever, St. Bernard, Border Collie, Beagle and Pug

Achievements

None
Niko Bellic Noodles
Niko Bellic Noodles is the name, love is my game. And fetch of course... I enjoy crunchy kibble and drinking from toilets. I don't like having to stay in the car when my people go inside. Fences are just challenges...I don't let them stop me! My favorite chews are underwear and rawhide...the rawhide lasts longer.
  • Purity 8%
  • Age 52 days
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATTATTAACAAGAACATGATACCTAGAATTA
G
C
A
T
T
A
T
T
A
A
C
A
A
G
A
A
C
A
T
G
A
T
A
C
C
T
A
G
A
A
T
T
A
Genes: 6FF484BJD2F

Composition

Yorkshire Terrier
27%
Husky
18%
Labrador BK
9%
Golder Retriever
9%
St. Bernard
9%
Border Collie
9%
Beagle
9%
Pug
9%

Current Energy

Vitality +4 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs Husky
Head Golder Retriever
Ears Husky
Snout St. Bernard
Mouth Border Collie
Nose Beagle
Eyes Pug
Color Yorkshire Terrier